ORIGINAL RESEARCH

https://doi.org/10.5005/jp-journals-10015-2049
World Journal of Dentistry
Volume 13 | Issue 3 | Year 2022

Increased Salivary Periodontal Pathogens and IL-17A in Oral Lichen Planus Patients with or without Periodontitis

Sineepat Talungchit¹, Waranun Buajeeb², Siribang-on Piboonniyom Khovidhunkit³, Rudee Surarit⁴, Kongthawat Chairatvit⁵, Sittiruk Roytrakul⁶, Hiroaki Kobayashi⁷, Yuichi Izumi⁸

¹Department of Oral Biology, Faculty of Dentistry, Mahidol University, Ratchathewi, Bangkok, Thailand; Department of Oral Surgery and Oral Medicine, Faculty of Dentistry, Srinakharinwirot University, Watthana, Bangkok, Thailand

²Department of Oral Medicine and Periodontology, Faculty of Dentistry, Mahidol University, Ratchathewi, Bangkok, Thailand

³Department of Advanced General Dentistry, Faculty of Dentistry, Mahidol University, Ratchathewi, Bangkok, Thailand

^4,5Department of Oral Biology, Faculty of Dentistry, Mahidol University, Ratchathewi, Bangkok, Thailand

⁶Functional Ingredients and Food Innovation Research Group, National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, Pathum Thani, Thailand

⁷Department of Periodontology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Bunkyo-ku, Tokyo, Japan

⁸Department of Periodontology, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Bunkyo-ku, Tokyo, Japan; Oral Care and Perio Center, Southern Tohoku Research Institute for Neuroscience, Southern Tohoku General Hospital, Fukushima, Japan

Corresponding Author: Waranun Buajeeb, Department of Oral Medicine and Periodontology, Faculty of Dentistry, Mahidol University, Ratchathewi, Bangkok, Thailand, Phone: +6622007841, e-mail: waranun.bua@mahidol.edu

ABSTRACT

Aim: Patients with oral lichen planus (OLP) who have gingival involvement are at increased risk for periodontal disease. This study aimed to investigate salivary levels of periodontopathic bacteria and inflammatory cytokines in OLP patients with or without periodontitis.

Materials and methods: Seventeen OLP patients and 20 control subjects were evaluated for their Periodontal Screening and Recording (PSR) score to classify if they had periodontitis. Four groups were studied, OLP patients with periodontitis (OLP-P), without periodontitis (OLP), periodontitis patients (P) and normal subjects (N). Salivary levels of Aggregatibacter actinomycetemcomitans (Aa), Fusobacterium nucleatum (Fn), Porphyromonas gingivalis (Pg), Prevotella intermedia (Pi), Treponema denticola (Td), and Tannerella forsythia (Tf) were determined by quantitative real-time polymerase chain reaction (qRT-PCR). Salivary levels of interleukin (IL)-1β, IL-6, and IL-17A were measured by enzyme-linked immunosorbent assay (ELISA).

Results: OLP-P and P groups had higher plaque index, bleeding on probing, and PSR scores than other groups. OLP-P and OLP patients had increased salivary Aa, Fn, Pi, Td, Tf with significantly high levels of Pi as well as high salivary IL-1β, IL-6, and IL-17A. IL-17A levels were significantly highest in the OLP-P group. Salivary IL-1β was significantly correlated with the level of Pi.

Conclusion: OLP patients with or without periodontitis had high levels of salivary periodontal pathogens and IL-17A.

Clinical significance: These data supported that OLP patients were at high risk for periodontitis. Oral hygiene maintenance in OLP patients with gingival lesions is of importance and could help prevent periodontitis.

How to cite this article: Talungchit S, Buajeeb W, Khovidhunkit SP, et al. Increased Salivary Periodontal Pathogens and IL-17A in Oral Lichen Planus Patients with or without Periodontitis. World J Dent 2022;13(3):182-190.

Source of support: Nil

Conflict of interest: None

Keywords: Oral lichen planus, Periodontal pathogens, Periodontitis, Salivary IL-17A

INTRODUCTION

Oral lichen planus (OLP) is a chronic inflammatory disease of established immune-mediated pathogenesis affecting oral mucosa.¹ It can be seen worldwide and a global prevalence of OLP was 1.01%.² OLP lesions are mostly observed in bilateral buccal mucosa. In some patients OLP lesions are restricted to the gingiva. This lesion is commonly represented as erythematous/atrophic and/or ulceration areas that affect the total width of the attached gingiva. This condition can be recognized as desquamative gingivitis (DG). Due to the pain and discomfort caused by desquamation of the gingiva, patient with this type of OLP may not be able to clean their gingiva properly and this may lead to plaque deposition and increased risk of long-term periodontal diseases.

It was found that patients with OLP had worse periodontal health than did healthy subjects.³ Mean Community Periodontal Index of Treatment Needs scores were significantly higher in OLP patients (2.8 ± 0.7) than in healthy controls (1.1 ± 0.8).³ Awareness of gingival involvement and periodontal disease in patients with OLP is of importance. Plaque control could reduce pain and severity of gingival OLP.⁴ These results indicated that both diseases have a bidirectional relationship, and they should be treated properly at the same time.

To determine the relationship between OLP and periodontal status, the periodontopathogen profile in OLP patients with gingivitis or periodontitis were investigated. In a study by Ertugrul et al.,⁵ subgingival plaque samples were subjected to multiplex polymerase chain reaction (PCR) followed by reverse hybridization methods (micro-IDent). The percentages of detection for Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Prevotella intermedia (Pi), Tannerella forsythia (Tf), and Treponema denticola (Td) were significantly higher in the OLP patients with gingivitis and periodontitis compared to the non-OLP patients with gingivitis and periodontitis. These pathogens, Aa, Pg, Pi, Tf, Td, are members of bacterial complexes related to the pathogenesis of periodontitis.⁶ In another study, Wang et al.⁷ investigated salivary microbiome and their potential roles in OLP. It was observed that the genus Streptococcus, Fusobacterium, Capnocytophaga, Porphyromonas, and Haemophilus were predominant in the saliva of patients with OLP compared to that of healthy controls.

Proinflammatory cytokines including interleukin (IL)-17, IL-6, and IL-1β have been studied in both OLP and periodontal disease. Serum concentration of IL-17 secreted by Th17 cells was higher in OLP patients than that in healthy control subjects. Regarding the severity of OLP, patients with erosive type had higher levels of serum IL-17 compared to patients with nonerosive type.⁸^-¹⁰ Moreover, higher serum concentrations of IL-17 have been detected in subjects with OLP who had periodontitis compared to subjects with periodontitis alone, or OLP alone and healthy controls.¹¹ Shen et al.¹² indicated that IL-17A, a principal effector of Th17 cells, and its microRNA targets of IL-17A, miR-635, and miR-578, played a role in the occurrence of OLP. Increased levels of IL-17 have been found in periodontitis patients indicating its role in the pathogenesis of periodontal disease.¹³

Salivary IL-6, one of the cytokines found in OLP, seemed to be related to the severity and possibly malignant transformation of OLP.¹⁴ Meta-analysis studies indicated high serum IL-6 in Asian population with OLP¹⁵ and a potential diagnostic value of salivary IL-6 compared with lower serum IL-6 in OLP patients.¹⁶ The effects of IL-6 on gingival fibroblast may lead to severe periodontitis.¹⁷ IL-1β stimulates inflammatory reactions and involves in the pathogenesis of periodontitis.¹⁸ High levels of IL-1β was also observed in OLP.¹⁹

As saliva contains microbes, inflammatory mediators, enzymes, and epithelial keratins,²⁰ saliva assay is a high potential diagnostic tool for screening and evaluating of oral diseases. Since there were no consensus findings on periodontopathogen profile and proinflammatory cytokines in OLP patients, we aimed to investigate salivary levels of six bacteria (Aa, Pg, Pi, Tf, Td, and Fusobacterium nucleatum (Fn)) and three proinflammatory cytokines, IL-1β, IL-6, and IL-17A, in OLP patients with or without periodontitis.

MATERIALS AND METHODS

Study Participants and Clinical Parameter Assessment

This cross-sectional case-control study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Institutional Review Board of the Faculty of Dentistry/Faculty of Pharmacy, Mahidol University (MU-DT/PY-IRB 2011/012.3103) for the use of human subjects in research. Participants were enrolled from the Oral Diagnostic Clinic, Oral Medicine Clinic and Advanced General Dentistry Clinic, Faculty of Dentistry, Mahidol University. They were OLP patients, patients with periodontitis (P) and normal subjects (N). All participants received thorough information regarding the aims and procedures of the study and written informed consents were completed.

This was the first study evaluating levels of periodontal pathogens and proinflammatory cytokines in saliva of four different groups of patients: (1) OLP patients with periodontitis (OLP-P), (2) OLP patients without periodontitis, (3) periodontitis patients without any oral mucosal lesions, and (4) healthy individuals. The sample size calculation was based on data from previous studies¹⁶^,²¹^,²² and the recommended effect size of 0.8 for a pilot study²³^,²⁴ with consideration of 90% power and a 5% level of significance using G Power 3.1 (University of Düsseldorf, Germany). A minimum of 28 patients were required for this study (seven patients for each group).

The exclusion criteria for all participants were (1) participants with diseases or condition that might affect salivary production such as Sjögren’s syndrome, cystic fibrosis, or previous radiotherapy; (2) participants who smoked; (3) participants who were pregnant; (4) participants with Candida infection, (5) participants who had taken antibiotics within 6 months.

The inclusion criteria for OLP patients were participants who had clinically and histopathologically diagnosed as OLP.²⁵ OLP patients under topical and systemic medications within one month were excluded.

The severity of OLP (OLP scores) was determined by a semiquantitative scoring system (REU: reticular/hyperkeratotic, erosive/erythematous, ulcerative) relating to the type and extent of the OLP lesions.²⁶ Patients with periodontitis without OLP and healthy subjects with neither OLP nor periodontitis were also recruited.

Periodontal Status Screening

The periodontal status of each participant was assessed for Periodontal Screening and Recording (PSR) index.²⁷ All teeth except third molars and retained roots were explored by WHO periodontal probe and the mouth of each participant was divided into six sextants. During the periodontal examination, the probe was inserted into the pocket and walked around each tooth. The examiner had to inspect the position of the color-coded band of the probe in relation to the gingival margin. After each tooth in the sextant was examined, only the highest score achieved was recorded and only one score is recorded for each sextant. Measurements were documented in a special box chart. The participants were diagnosed as healthy gingiva when they received maximum PSR score 0; diagnosed as gingivitis when they received maximum PSR score 1 or 2; and diagnosed as chronic periodontitis when they received maximum PSR score 3 in two or more sextants or PSR score 4 in at least one sextant. PSR scores has been approved to use for prediction of periodontitis.²⁷ A significant correlation of PSR with the American Academy of Periodontology (AAP) disease categories (R2 = 0.43, p < 0.0001) was found. Furthermore, PSR score has been used to evaluate periodontitis in patients with systemic diseases.²⁸ As the PSR assessment is convenient for general dentists and could be used to detect periodontitis, they were used in this study.

Plaque index (PI) modified from the method of Turesky et al.²⁹ and bleeding on probing (BOP)³⁰ of each participant were also recorded.

Clinical parameters were assessed by S. The recruited participants were divided into four groups according to their oral mucosal and periodontal status. The OLP-P group composed of seven OLP patients with periodontitis. The OLP group included 10 OLP patients without periodontitis. The P group composed of 10 periodontitis patients without any visible oral mucosal lesions except periodontitis and the N group included 10 healthy subjects without OLP nor periodontitis.

Human Saliva Sampling

Before any clinical testing could begin, saliva samples were collected. The entire unstimulated saliva was collected using Navazesh’s standard method.³¹ Briefly, the saliva samples were collected between 9 am and 12 pm For a minimum of one hour, participants were asked to abstain from eating, drinking, or using oral hygiene products. The participants were instructed to stop swallowing and expel all their saliva into the 5 ml centrifuge tube as soon as it was full. To remove debris and cells, the saliva was centrifuged at 2,600 gm, 4°C for 15 minutes after it was immediately placed on ice and cooled. The supernatant was then treated with a cocktail of protease inhibitors (Roche Diagnostics GmbH, Mannheim, Germany). After that, the supernatant was divided into smaller portions and stored at –80°C until needed.

Bacterial DNA Extraction and Real-time PCR Assay

Bacterial DNA was extracted from saliva samples using the QIAamp DNA Mini Kit (QIAGEN Inc., CA, USA) according to the manufacturer’s instructions. Subsequently, the purity and yield of DNA were measured using NanoDrop Lite Spectrophotometer (Thermo Fisher Scientific, WI, USA).

qRT-PCR assay was performed using Thermal Cycler Dice® Real Time System II (TaKaRa Bio Inc., Shiga, Japan). Two qRT-PCR systems, TagMan qRT-PCR and SYBR Green qRT-PCR systems were used in this study. TagMan qRT-PCR analysis was used for the detection of Aa, Fn, Pg, Pi, Td, and Tf, while SYBR Green qRT-PCR analysis was used for the detection of total bacteria as previously described.³² Species-specific primers and probes for Aa, Fn, Pg, Pi, Td, and Tf, and primers for total bacteria are listed in Table 1. Negative control, which contained all of the real-time PCR mixture except equal volume of DNA was replaced by sterilized DNase-RNase-free deionized water, was included in each run.

**Table 1:** The nucleotide sequences of qPCR primers and TaqMan probes
	Forward primer	Reverse primer	TaqMan probe
Bacterium	(5’ to 3’)	(5’ to 3’)	(5’ to 3’)
A. actinomycetemcomitans	TCTTACCTACTCTTGACATCCGAA	ATGCAGCACCTGTCTCAAAGC	AGAACTCAGAGATGGGTTTGTGCCTTAG
F. nucleatum	GTCAGGATGAGAAATCTAAGGC	CCTCGTGCGCTTTGTATC	GAAGAGGAGCCCTTGTGTGTGAGTATAC
P. gingivalis	TAGCTTGCTAAGGTCGATGG	CAAGTGTATGCGGTTTTAGT	TGCGTAACGCGTATGCAACTTGCC
P. intermedia	CCGCCTAATACCCGATGTTG	CCCATCCTCCACCGATGA	CACATATGGCATCTGACGTGGACCAAA
T. denticola	AGAGCAAGCTCTCCCTTACCGT	TAAGGGCGGCTTGAAATAATAATG	CAGCGTTCGTTCTGAGCCAGGATCA
T. forsythia	CGACGGAGAGTGAGAGCTTTCT	GCGCTCGTTATGGCACTTAAG	CGTCTATGTAGGTGCTGCATGGTTGTCG
Total bacteria	GTGSTGCAYGGYTGTCGTCA	ACGTCRTCCMCACCTTCCTC	–

A standard curve for quantification of periodontopathic bacteria (Aa, Fn, Pg, Pg, Td, and Tf) was constructed using artificial synthetic gene (Eurofins Genomics, Ebersberg, Germany). While purified Pg DNA (Eurofins Genomics) was used to construct a standard curve for total bacteria. All data were analyzed using Thermal Cycler Dice Real Time System Software (Takara-bio Inc.).

Determination of Salivary Interleukin-1β, Interleukin-6, and Interleukin-17A

Saliva supernatants were defrosted at room temperature for 30 minutes prior to the assays. IL-1β, IL-6, and IL-17A concentrations in saliva samples were determined using commercially available enzyme-linked immunosorbent assay (ELISA) kits for human IL-1β and IL-6 (Bioscience Inc., San Diego, USA) and human IL-17A (Diaclone, Besancon Cedex, France) according to the manufacturer’s instructions. Using a VMax Kinetic ELISA Microplate Reader, the absorbance of the saliva samples was measured at 450 nm (Molecular Devices Corporation, Sunnyvale, CA, USA). In each experiment, the standard curve was organized using the SoftMax Pro Data Acquisition and Analysis Software (Molecular Devices Corporation) installed in the microplate reader. The concentrations of cytokines in the saliva samples were determined using standard curves. Protein concentrations were expressed in pg/mL, and the manufacturer provided the minimum detectable doses for each ELISA kit.

Statistical Analysis

All data were analyzed with SPSS 22.0 software (SPSS Inc., IL, USA). Log transformations were used to approximate a normal distribution of the data. The quantity of bacteria and levels of salivary cytokines were displayed in the log base. The amount of periodontopathic bacteria, total bacteria, and salivary levels of IL-1ß, IL-6, and IL-17A are presented with Mean ± SD. The Shapiro-Wilk test was used to test for normality. For normal distributed data, One-way ANOVA, and Post Hoc test (Bonferrini test) were used to compare the differences in amounts of periodontopathic bacteria, total bacteria, and salivary levels of IL-1ß, IL-6, and IL-17A between each participant group. For PSR score that presented in ordinal scale, the Kruskal-Wallis test was used to check any significant differences through all study groups. The Mann-Whitney U test was used to compare the differences among each group of participants. PSR score was presented with median, 1st quartile (Q1) and 3rd quartile (Q3). The correlation coefficient was analyzed using Pearson correlation. Statistical significance was recognized at p < 0.05 in all tests.

RESULTS

Patient Characteristics and Clinical Parameters

Demographic characteristics and clinical parameters of the 37 study subjects in 4 study groups (OLP-P, P, OLP, and N groups) are showed in Table 2. There were four patients in OLP group and three normal subjects that belonged to a previous study.³³ There was no statistical difference in gender and age among the four groups (p > 0.05). Moreover, there was no significant difference in OLP scores between the OLP-P and OLP groups (Table 2).

**Table 2:** Demographic characteristics and clinical parameters of the four study groups
	OLP-P group	P group	OLP group	N group
Number of participants	7	10	10	10
Gender (female/male)	6/1	7/3	8/2	8/2
Age (years):
• Mean ± SD • Range	56.29 ± 10.45 43–71	51.7 ± 12.99 36–78	55.4 ± 15.78 30–76	55.7 ± 12.98 33–71
PI: Mean ± SD	1.34 ± 0.31	2.14 ± 0.46	0.65 ± 0.32	0.55 ± 0.56
BOP (%): Mean ± SD	76.91 ± 8.55	87.02 ± 10.86	36.39 ± 17.55	15.88 ± 11.36
PSR score (max): Median (Q1, Q3)	3.00 (3.00, 3.00)	3.00 (3.00, 4.00)	2.00 (1.00, 2.00)	2.00 (1.00, 2.00)
Gingival lesion involvement (number/total number)	6/7	–	9/10	–
OLP score	14.71 ± 7.24	–	16.75 ± 7.38	–

PI, plaque index; BOP, bleeding on probing; PSR, periodontal screening and recording; OLP-P, oral lichen planus with periodontitis; P, nonoral lichen planus with periodontitis; OLP, oral lichen planus with gingivitis or healthy gingiva; N, non-OLP with gingivitis or healthy gingiva

The periodontal clinical parameters, PI, BOP, and maximum PSR score, were significantly different between participants with chronic periodontitis (including the OLP-P and P groups) and participants with gingivitis or healthy gingiva (the OLP and N groups) (p < 0.05).

The PI score was significantly higher in the P group compared to the OLP-P group (p < 0.01). Significant difference of PI scores was revealed between the OLP-P and OLP groups. However, no significant difference in PI score was observed between the OLP and N groups (p = 0.25) (Table 2).

Regarding to BOP status, the percentage of BOP was highest in the P group. No significant difference in BOP score was observed between the OLP-P and P groups (p = 0.39). However, BOP score was significantly higher in the OLP group compared to the N group (p <0.01).

Comparable to PI score, maximum PSR score was significantly higher in the P group compared to the OLP-P (p = 0.04), OLP (p < 0.001), and N (p < 0.001) groups. No significant difference in maximum PSR score between the OLP and N groups was observed (p = 0.74).

Periodontopathic Bacteria

The periodontopathic bacteria including Aa, Fn, Pg, Pi, Td, and Tf, and total bacteria were detected in saliva samples of all four groups (Figs 1A to G). Tf was detected in the highest mean level in all four groups (Fig. 1F), while Aa demonstrated the lowest mean level (Fig. 1A). Significantly high salivary Pi was observed in OLP patients compared to normal subjects and its level was comparable to that of OLP-P and P groups (Fig. 1D).

Figs 1A to G: (A to F) Graph represents quantification of periodontopathic bacteria and (G) total bacteria in saliva samples from the four study groups. OLP-P, oral lichen planus with periodontitis; P, nonoral lichen planus with periodontitis; OLP, oral lichen planus with gingivitis or healthy gingiva; N, non-OLP with gingivitis or healthy gingiva; Aa, Aggregatibacter actinomycetemcomitans; Fn, Fusobacterium nucleatum; Pg, Porphyromonas gingivalis; Pi, Prevotella intermedia; Td, Treponema denticola; Tf, Tannerella forsythia; *p < 0.05, **p < 0.01

Salivary Cytokine Levels

The ELISA analysis revealed significantly elevated levels of salivary IL-1ß and IL-6 in the OLP-P, P, and OLP groups compared to the N group. However, there was no significant difference among the OLP-P, P, and OLP groups (Figs 2A and B). The salivary IL-17A levels were significantly higher in the OLP-P group than those of the P, OLP, and N groups (Fig. 2C).

Figs 2A to C: (A) Bar graph depicts log salivary levels of IL-1ß, (B) IL-6 and (C) IL-17A in the 4 study groups. OLP-P, oral lichen planus with periodontitis; P, nonoral lichen planus with periodontitis; OLP, oral lichen planus with gingivitis or healthy gingiva; N, non-OLP with gingivitis or healthy gingiva; *p < 0.05, **p < 0.01, ***p < 0.001

Correlation between Salivary Cytokines and Periodontal Pathogens

We analyzed the correlation between salivary cytokine levels and periodontal pathogens using Pearson correlation. Table 3 shows that salivary IL-1β levels were positively correlated with Aa, Pg, Pi, Td, and Tf; IL-6 levels were positively correlated with Aa and Tf. While there was no significant correlation between salivary IL-17A levels and each periodontal pathogen.

**Table 3:** Correlation between salivary cytokines and periodontal pathogens
	Salivary cytokine levels (pg/mL)
Periodontopathic bacteria	IL-1β	IL-6	IL-17A
A. actinomycetemcomitans (n = 37)	0.343^*	0.397^*	0.034
F. nucleatum (n = 37)	0.281	0.249	0.168
P. gingivalis (n = 37)	0.444^**	0.230	0.142
P. intermedia (n = 37)	0.570^***	0.265	0.213
T. denticola (n = 29)	0.533^**	0.231	0.158
T. forsythia (n = 36)	0.481^**	0.358^*	0.271
Total bacteria (n = 37)	0.288	0.301	0.336

Bold denotes statistical significance. ^*p < 0.05, ^**p < 0.01, ^***p < 0.001

DISCUSSION

Over the last few years, salivary testing is rapidly growing as a practical tool in research and practice to determine early signs of systemic and oral diseases. Even though dental plaque and gingival crevicular fluid (GCF) have been used more often as sampling materials for the detection of periodontal pathogens, some reports indicated that saliva could also be used as a representative diagnostic specimen for periodontal disease.³⁴ Periodontal pathogens were equal or more frequently detected and quantified in saliva than in subgingival plaque samples by qRT-PCR.³⁵ Therefore, we chose to use this technique to identify periodontopathic bacteria in the saliva of patients with OLP with or without periodontitis.

This study was among the first studies to determine periodontal status, periodontopathic and total bacteria levels in saliva of OLP patients with periodontitis compared to patients with periodontitis alone, OLP patients without periodontitis and normal controls. We also determined the severity of OLP lesions in patients with and without periodontitis. Our results showed that periodontal status was worst in the P group compared to the other groups. When the levels of periodontopathic bacteria were investigated, it was found that the periodontopathic and total bacteria levels were higher in the P group than in the normal group, which corresponded to the PI score and several previous studies which revealed that the levels of periodontopathic bacteria are related with PI scores.³⁶ López-Jornet et al.³ found that OLP patients had poor periodontal condition compared with normal subjects. Their finding was consistent with this study in that the PI and percentage of BOP were higher in the OLP, and OLP-P groups compared to the N group. When the levels of periodontopathic bacteria were investigated, several periodontopathic bacteria including Aa, Fn, Pi, and Td were increased in the OLP group compared to the N group although significant differences were retrieved for Pi only (Fig. 1). Moreover, the levels of Tf was not different between the OLP and the N groups in our study. These results were similar to a study of Wang et al.³⁷ in that increased abundance of these four bacteria were revealed in the saliva of OLP patients compared to the healthy control subjects and no significant difference in levels of Tf was detected between the OLP and the normal control groups.

Significantly higher Pi levels in the OLP-P and OLP groups compared to the N group in our study were consistent with the study of Bornstein et al.³⁸ which demonstrated the significantly higher bacterial counts for Pi at lesions in subjects with OLP compared to sites in control subjects. Moreover, higher count of salivary Fn was observed in OLP group compared to the N group. Similarly, He et al.³⁶ showed increased abundance of Fusobacterium in patients with OLP.

Our study also indicated that no significant difference of Pg levels in the saliva was detected among the four groups. This result was consistent with the study of Thanakun et al.³² which showed that the presence of Pg in the saliva of a group of Thai population was not significantly related to periodontitis. However, this result was different from the study of Wang et al.³⁷ which found that the abundance of Porphyromonas species in the saliva was higher in the OLP group compared to the healthy controls. This might be due to difference in methodology between both studies and further investigation may be needed to confirm these results.

Comparing our results with another study which investigated the levels of periodontopathic bacteria in plaque samples, Ertugrul et al.⁵ studied periodontopathogen profile including Aa, Pi, Pg, Td, and Tf in the subgingival plaque retrieved from healthy subjects with gingivitis or periodontitis and in OLP patients with gingivitis or periodontitis. In their study, subgingival plaque samples were subjected to multiplex PCR analysis with subsequent micro-IDent. The percentages of detection of these bacteria were higher in the OLP group than the non-OLP group. They concluded that OLP patients had a greater tendency to be infected with periodontal pathogens (Aa, Pi, Pg, Td, and Tf) than healthy subjects with gingivitis or periodontitis. These results are similar to our study on saliva which showed higher levels of most periodontal pathogens and total bacteria in the OLP-P and OLP groups compared with normal controls although no significant differences were found. This implied that salivary pathogens could represent subgingival plaque bacteria. Our study indicated that the P group had the highest levels of periodontopathic and total bacteria compared to the other three groups. This apparent difference may be the consequence of different samples (subgingival plaques vs saliva), methods (micro-IDent vs qRT-PCR), reported data (percentages of detection vs levels of bacteria), and periodontal parameters.

Several cytokines play important roles in periodontal and immune-mediated oral diseases. Since some recent reports indicated different levels of proinflammatory cytokines especially IL-1β, IL-6, and IL-17 between patients with and without OLP, we investigated the salivary cytokines levels of IL-1β, IL-6, and IL-17A using ELISA technique to determine the inflammatory status in each group of participants. We found that salivary IL-1β and IL-6 levels were significantly increased in the OLP-P, P, and OLP groups compared to the N group. However, there was no significant difference in the levels of these cytokines among the OLP-P, P, and OLP groups. These results corresponded to a previous study which found that salivary IL-1β and IL-6 levels were higher in patients with OLP and chronic periodontitis compared to healthy controls.³⁹ IL-1β and IL-6 levels may be related to the inflammatory level and our study found that these inflammatory levels were similar in the OLP-P, P, and OLP groups. As our findings presented correlation between the expressions of periodontal pathogens and IL-1β and IL-6, the effects of microbiome on pathogenesis of OLP could not be excluded.³⁷

Interestingly, our study was among the first studies to determine the salivary concentration of IL-17A in patients with OLP and periodontitis compared to patients with periodontitis alone, patients with OLP alone and normal controls. Since we were interested in periodontal disease in OLP, patients with similar severity of OLP were included. The observation of very high expression of IL-17A in saliva of OLP patients with periodontitis was striking. The levels of IL-17A in the OLP-P group were highest. The major role of IL-17 has been specified and found to participate in the development of autoimmune diseases, inflammation-mediated destruction, and tumor microenvironments.⁷^,⁴⁰ In addition, IL-17 has an important role for host defense against bacterial and fungal infection by activating inflammatory responses.⁴¹ For more specificity in periodontal disease, IL-17 played a protective role against bacterial infections via neutrophil recruitment to destructed area in periodontitis lesions, where neutrophils play a critical role in antimicrobial defense against periodontal organisms.⁴²

Several reports indicated that IL-17 cytokine played a pivotal role in chronic inflammatory diseases including periodontitis and OLP.⁹^,¹²^,⁴³ Immunohistochemistry disclosed elevated number of cells with IL-17 in periodontitis tissue and treatment of IL-17 could induce production of IL-1ß and TNF-α from macrophages as well as IL-6 and IL-8 from gingival fibroblasts.⁴³ Some studies also used immunohistochemical technique to indicate higher number of Th17 cells in OLP tissues compared to normal oral mucosa.⁴⁴^,⁴⁵ Serum levels of IL-17 was found to be elevated in OLP patients compared to normal controls and serum levels of IL-17 were found to be higher in patients with erosive form of OLP than those of patients with nonerosive form of OLP.¹⁰ In addition, higher serum concentrations of IL-17 have been detected in patients with OLP-P than patients with periodontitis, patients with OLP and healthy control participants, respectively.¹¹ Comparable to our study, Wang et al.⁷ also demonstrated that salivary concentrations of IL-17 from patients with erosive OLP were significantly higher than that of subjects with reticular OLP and healthy controls. These data emphasized the idea that IL-17 plays a significant role in the pathogenesis of both OLP and periodontitis.

The very high expression of IL-17A in the OLP-P group could be due to the nature of inflammation caused by both OLP and periodontitis. High level of salivary IL-17A in our OLP-P group was correlated well with increased serum IL-17 in OLP with chronic periodontitis.¹¹ The synergistic inflammatory effect of both diseases might give rise to such a high level of IL-17A. OLP with chronic periodontitis patients get higher expression level of serum IL-17.¹¹ Levels of IL-17 were found to be elevated in autoimmune diseases such as multiple sclerosis, rheumatoid arthritis, and collagen-induced arthritis.⁴² This previous study⁴² and our study indicated that IL-17 may participate in immunopathogenesis of OLP. To answer whether IL-17 plays a significantly role in the pathogenesis of OLP or not, a further cohort study to follow up OLP patients after clinical improvement and more subjects may be needed in the future.

We acknowledged that our study had some limitations including small sample sizes and diagnostic criteria of periodontitis. Diagnosis of periodontal disease usually requires a comprehensive periodontal examination including full mouth probing depths (PD), clinical attachment levels (CAL) and presence of tooth mobility. Since this is our first study to investigate the IL-17 levels in OLP patients with or without periodontitis, further study in larger sample sizes using stringent periodontal criteria instead of using only PI, BOP, and PSR score may be needed to confirm these results. In addition, a comprehensive periodontal examination and charting should be performed to determine an appropriate plan for periodontal treatment, especially in patients who has received PSR score ≥3.

CONCLUSION

OLP patients with/without periodontitis had increased salivary Aa, Fn, Pi, Td, Tf with significantly high levels of Pi as well as high IL-1β, IL-6, and IL-17A. Highest level of IL-17A in OLP-P was noted. Salivary IL-1β was significantly correlated with the level of Pi.

CLINICAL SIGNIFICANCE

Our data supported that OLP patients were at high risk for periodontitis. Oral hygiene maintenance in OLP patients with gingival lesions is of importance and could help prevent periodontitis.

ACKNOWLEDGMENTS

This study was supported mainly by a grant from the Thailand Research Fund through the Royal Golden Jubilee PhD Program (Grant No.PHD/54/2550) to S Talungchit and W Buajeeb, and partly by a grant from Mahidol University under the National Research Universities Initiative. The authors would like to thank the staff of the Department of Oral Medicine and Periodontology as well as the staff of the Department of Advanced General Dentistry for their assistance in this study.

Manufacturer Name

Protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany)
QIAamp DNA Mini Kit (QIAGEN Inc., California, USA)
NanoDrop Lite Spectrophotometer (Thermo Fisher Scientific, Wisconsin, USA)
Thermal Cycler Dice^® Real Time System II and Thermal Cycler Dice Real Time System Software (TaKaRa Bio Inc., Shiga, Japan)
Artificial synthetic gene and purified Pg DNA (Eurofins Genomics, Ebersberg, Germany)
Enzyme-linked immunosorbent assay (ELISA) kits for human IL-1β and IL-6 (Bioscience Inc., San Diego, USA)
ELISA kits for human IL-17A (Diaclone, Besancon Cedex, France)
VMax Kinetic ELISA Microplate Reader and SoftMax Pro Data Acquisition and Analysis Software (Molecular Devices Corporation, Sunnyvale, CA, USA)
SPSS 22.0 software (SPSS Inc., Illinois, USA).

REFERENCES

1. Shivhare P, Gupta A, Yadav M, et al. Evaluation of different diagnostic criteria of diseases manifesting the oral cavity - a review. Part-1. J Oral Biol Craniofac Res 2016;6(2):135–141. DOI: 10.1016/j.jobcr.2015.12.012

2. Gonzalez-Moles MA, Warnakulasuriya S, Gonzalez-Ruiz I, et al. Worldwide prevalence of oral lichen planus: a systematic review and meta-analysis. Oral Dis 2021;27(4):813–828. DOI: 10.1111/odi.13323

3. López-Jornet P, Camacho-Alonso F. Periodontal conditions in patients with oral lichen planus: a pilot study. Quintessence Int 2012;43(2):147–152. PMID: 22257877.

4. Alsarraf A, Mehta K, Khzam N. The gingival oral lichen planus: a periodontal-oral medicine approach. Case Rep Dent 2019:4659134. DOI: 10.1155/2019/4659134

5. Ertugrul AS, Arslan U, Dursun R, et al. Periodontopathogen profile of healthy and oral lichen planus patients with gingivitis or periodontitis. Int J Oral Sci 2013;5(2):92–97. DOI: 10.1038/ijos.2013.30

6. Kim EH, Joo JY, Lee YJ, et al. Grading system for periodontitis by analyzing levels of periodontal pathogens in saliva. PLoS One 2018;13(11):e0200900. DOI: 10.1371/journal.pone.0200900

7. Wang K, Miao T, Lu W, et al. Analysis of oral microbial community and Th17-associated cytokines in saliva of patients with oral lichen planus. Microbiol Immunol 2015;59(3):105–113. DOI: 10.1111/1348-0421.12232

8. Shaker O, Hassan AS. Possible role of interleukin-17 in the pathogenesis of lichen planus. Br J Dermatol 2012;166(6):1367–1368. DOI: 10.1111/j.1365-2133.2011.10793.x

9. Xie S, Ding L, Xiong Z, et al. Implications of Th1 and Th17 cells in pathogenesis of oral lichen planus. J Huazhong Univ Sci Technolog Med Sci 2012;32(3):451–457. DOI: 10.1007/s11596-012-0078-7

10. Pouralibaba F, Babaloo Z, Pakdel F, Aghazadeh M. Serum level of interleukin 17 in patients with erosive and non erosive oral lichen planus. J Dent Res Dent Clin Dent Prospects 2013;7(2):91–94. DOI: 10.5681/joddd.2013.016

11. Wang H, Luo Z, Lei L, et al. Interaction between oral lichen planus and chronic periodontitis with Th17-associated cytokines in serum. Inflammation 2013;36(3):696–704. DOI: 10.1007/s10753-013-9594-2

12. Shen Z, Zhang C, Zhou Z, et al. Altered expression of interleukin-17A and its targeting microRNAs in oral lichen planus: a pilot study. Oral Surg Oral Med Oral Pathol Oral Radiol 2016;122(5):619–624.e1. DOI: 10.1016/j.oooo.2016.07.005

13. Zenobia C, Hajishengallis G. Basic biology and role of interleukin-17 in immunity and inflammation. Periodontol 2000 2015;69(1):142–159. DOI: 10.1111/prd.12083

14. Humberto JSM, Pavanin JV, Rocha M, Motta ACF. Cytokines, cortisol, and nitric oxide as salivary biomarkers in oral lichen planus: a systematic review. Braz Oral Res 2018;32:e82. DOI: 10.1590/1807-3107bor-2018.vol32.0082

15. Yin M, Li G, Song H, et al. Identifying the association between interleukin-6 and lichen planus: a meta-analysis. Biomed Rep 2017;6(5):571–575. DOI: 10.3892/br.2017.887

16. Mozaffari HR, Sharifi R, Sadeghi M. Interleukin-6 levels in the serum and saliva of patients with oral lichen planus compared with healthy controls: a meta-analysis study. Cent Eur J Immunol 2018;43(1):103–108. DOI: 10.5114/ceji.2018.74880

17. Naruishi K, Nagata T. Biological effects of interleukin-6 on Gingival Fibroblasts: cytokine regulation in periodontitis. J Cell Physiol 2018;233(9):6393–6400. DOI: 10.1002/jcp.26521

18. Cheng R, Wu Z, Li M, Shao M, Hu T. Interleukin-1beta is a potential therapeutic target for periodontitis: a narrative review. Int J Oral Sci 2020;12(1):2. DOI: 10.1038/s41368-019-0068-8

19. Jeong SH, Na HS, Park SH, et al. Topical sulfasalazine for unresponsive oral lichen planus. Quintessence Int 2016;47(4):319–327. DOI: 10.3290/j.qi.a34974

20. Javaid MA, Ahmed AS, Durand R, Tran SD. Saliva as a diagnostic tool for oral and systemic diseases. J Oral Biol Craniofac Res 2016;6(1):66–75. DOI: 10.1016/j.jobcr.2015.08.006

21. Batool H, Nadeem A, Kashif M, et al. Salivary levels of IL-6 and IL-17 could be an indicator of disease severity in patients with Calculus associated chronic periodontitis. Biomed Res Int 2018;2018:8531961. DOI: 10.1155/2018/8531961

22. Kaushik R, Yeltiwar RK, Pushpanshu K. Salivary interleukin-1beta levels in patients with chronic periodontitis before and after periodontal phase I therapy and healthy controls: a case-control study. J Periodontol 2011;82(9):1353–1359. DOI: 10.1902/jop.2011.100472

23. Lakens D. Calculating and reporting effect sizes to facilitate cumulative science: a practical primer for t-tests and ANOVAs. Front Psychol 2013;4:863. DOI: 10.3389/fpsyg.2013.00863

24. Whitehead AL, Julious SA, Cooper CL, Campbell MJ. Estimating the sample size for a pilot randomised trial to minimise the overall trial sample size for the external pilot and main trial for a continuous outcome variable. Stat Methods Med Res 2016;25(3):1057–1073. DOI: 10.1177/0962280215588241

25. van der Meij EH, van der Waal I. Lack of clinicopathologic correlation in the diagnosis of oral lichen planus based on the presently available diagnostic criteria and suggestions for modifications. J Oral Pathol Med 2003;32(9):507–512. DOI: 10.1034/j.1600-0714.2003.00125.x

26. Piboonniyom SO, Treister N, Pitiphat W, et al. Scoring system for monitoring oral lichenoid lesions: a preliminary study. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005;99(6):696–703. DOI: 10.1016/j.tripleo.2004.07.013

27. Primal KS, Esther SR, Boehm TK. Periodontal screening and recording (PSR) index scores predict periodontal diagnosis. J Dent App 2014;1(1):8–12. ISSN:2381-9049

28. Techatanawat S, Surarit R, Chairatvit K, et al. Salivary and serum interleukin-17A and interleukin-18 levels in patients with type 2 diabetes mellitus with and without periodontitis. PLoS One 2020;15(2):e0228921. DOI: 10.1371/journal.pone.0228921

29. Turesky S, Gilmore ND, Glickman I. Reduced plaque formation by the chloromethyl analogue of victamine C. J Periodontol 1970;41(1):41–43. DOI: 10.1902/jop.1970.41.41.41

30. Newbrun E. Indices to measure gingival bleeding. J Periodontol 1996;67(6):555–561. DOI: 10.1902/jop.1996.67.6.555

31. Navazesh M. Methods for collecting saliva. Ann NY Acad Sci 1993;694:72–77. DOI: 10.1111/j.1749-6632.1993.tb18343.x

32. Thanakun S, Pornprasertsuk-Damrongsri S, Gokyu M, et al. Inverse association of plasma IgG antibody to Aggregatibacter actinomycetemcomitans and high c-reactive protein levels in patients with metabolic syndrome and periodontitis. PLoS ONE 2016;11(2):e0148638. DOI: 10.1371/journal.pone.0148638

33. Talungchit S, Buajeeb W, Lerdtripop C, et al. Putative salivary protein biomarkers for the diagnosis of oral lichen planus: a case-control study. BMC Oral Health 2018;18(1):42. DOI: 10.1186/s12903-018-0504-8

34. Paju S, Pussinen PJ, Suominen-Taipale L, et al. Detection of multiple pathogenic species in saliva is associated with periodontal infection in adults. J Clin Microbiol 2009;47(1):235–238. DOI: 10.1128/JCM.01824-08

35. Haririan H, Andrukhov O, Bertl K, et al. Microbial analysis of subgingival plaque samples compared to that of whole saliva in patients with periodontitis. J Periodontol 2014;85(6):819–828. DOI: 10.1902/jop.2013.130306

36. He J, Huang W, Pan Z, et al. Quantitative analysis of microbiota in saliva, supragingival, and subgingival plaque of Chinese adults with chronic periodontitis. Clin Oral Investig 2012;16(6):1579–1588. DOI: 10.1007/s00784-011-0654-4

37. Wang K, Lu W, Tu Q, et al. Preliminary analysis of salivary microbiome and their potential roles in oral lichen planus. Sci Rep 2016;6:22943. DOI: 10.1038/srep22943

38. Bornstein MM, Hakimi B, Persson GR. Microbiological findings in subjects with asymptomatic oral lichen planus: a cross-sectional comparative study. J Periodontol 2008;79(12):2347–2355. DOI: 10.1902/jop.2008.080303

39. Kaur J, Jacobs R. Proinflammatory cytokine levels in oral lichen planus, oral leukoplakia, and oral submucous fibrosis. J Korean Assoc Oral Maxillofac Surg 2015;41(4):171–175. DOI: 10.5125/jkaoms.2015.41.4.171

40. Tesmer LA, Lundy SK, Sarkar S, et al. Th17 cells in human disease. Immunol Rev 2008;223:87–113. DOI: 10.1111/j.1600-065X.2008.00628.x

41. Romagnani S, Maggi E, Liotta F, et al. Properties and origin of human Th17 cells. Mol Immunol 2009;47(1):3–7. DOI: 10.1016/j.molimm.2008.12.019

42. Yu JJ, Ruddy MJ, Wong GC, et al. An essential role for IL-17 in preventing pathogen-initiated bone destruction: recruitment of neutrophils to inflamed bone requires IL-17 receptor–dependent signals. Blood 2007;109(9):3794–3802. DOI: 10.1182/blood-2005-09-010116

43. Beklen A, Ainola M, Hukkanen M, et al. MMPs, IL-1, and TNF are regulated by IL-17 in periodontitis. J Dent Res 2007;86(4):347–351. DOI: 10.1177/154405910708600409

44. Lu R, Zeng X, Han Q, et al. Overexpression and selectively regulatory roles of IL-23/IL-17 axis in the lesions of oral lichen planus. Mediators Inflamm 2014;2014:701094. DOI: 10.1155/2014/701094

45. Maehara T, Moriyama M, Kawano S, et al. Cytokine profiles contribute to understanding the pathogenic difference between Good syndrome and oral lichen planus: two case reports and literature review. Medicine (Baltimore) 2015;94(14):e704. DOI: 10.1097/MD.0000000000000704

________________________
© The Author(s). 2022 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (https://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted use, distribution, and non-commercial reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.